hslc9a6 aav expression plasmid  (Addgene inc)

Journal: STAR Protocols

Article Title: Protocol for targeted gene manipulation and thermogenic evaluation in mouse brown adipocytes

doi: 10.1016/j.xpro.2025.104317

Figure Lengend Snippet: Assessment of Futile Creatine Cycle within mature brown adipocytes (A) Representative immunofluorescence images of iBAT transduced with AAV-FLEX-GFP-FLAG. Mature adipocytes were labelled with anti-Perilipin 1 (PLIN1) antibody (red), GFP-FLAG was labeled with anti-FLAG antibody (green). Nuclei were labelled with DAPI (blue). Scale bar, 100 μm. Figure adapted from figure 1d of Bunk et al. (B) Oxygen consumption rates basally and following sequential additions of noradrenaline (NA, 0.1 μM) and oligomycin (Oligo, 15 μM). SBI-425 (10 μM) was added at the start (n = 2 independent preparations/sex). Figure adapted from figure 5b of Bunk et al. Two-way ANOVA (Tukey’s post-hoc test). Data are represented as mean ± SEM.

Article Snippet: AAV GFP (plasmid) , Addgene , 49055.

Techniques: Immunofluorescence, Transduction, Labeling

Journal: bioRxiv

Article Title: In vivo interrogation of transcriptional and epigenetic regulators of lung epithelial regeneration

doi: 10.64898/2026.03.13.711474

Figure Lengend Snippet: (A). Immunofluorescence (IF) images of in vivo AT2 transduction using AAV9. Green: eGFP; Red: proSPC. Yellow arrows indicate the AT2s (proSPC + ) that are infected by AAV9-eGFP. Scale bars, 50 μm. (B). Schematic of the SAGE (AAV-SBase-intron) system. (C). Experimental design for quantification of genome integration efficiency of engineered AAV systems. Lungs were harvested from mice seven days after i.t. administration. (D). Representative widefield images of the organoids grown from AT2s transduced by SAGE. mScarlet + AT2s were harvested as CD45 - Pdgfra - CD31 - EpCAM + MHCII + CD104 - . Scale bars, 200 μm. (E). Quantification for integration efficiency of AAV9 and SAGE using the AT2 clonal organoid assay. N = 3 and 12 mice were used for AAV9 and SAGE, respectively. Error bars: mean ± SEM. (F). IF images illustrating Sftpc gene knockout in AT2s. AT2-specific knockouts were achieved through AT2-Cas9-eGFP mice following tamoxifen treatment and subsequent SAGE gRNA delivery (detailed experimental scheme in ). A gRNA targeting the Tigre locus , a genomic safe harbor in the mouse genome, was used as a control. Green: eGFP representing Cas9 expression; yellow: mScarlet, representing SAGE transduction; cyan, proSPC. White dashed lines indicate AT2s expressing Cas9 and gRNA that have lost proSPC expression. White solid lines indicate AT2s expressing Cas9 and gRNA that have retained proSPC expression. Scale bars, 50 μm. (G). Quantification of proSPC knockout effects in AT2s that are mScarlet + eGFP + . N = 4 mice were used for each condition. Error bars: mean ± SEM.

Article Snippet: In brief, 5 μl of the fraction after ultracentrifugation, isolated AAVs or Addgene AAV standards (Adgene #37825-AAV9) were treated with with DNase I (Merck, 11284932001) at 37 °C for at least 1 hr, followed by Proteinase K digestion at 56 °C for at least 2 hrs before preparing a threefold serial dilutions with ddH2O. qPCR reactions with primers targeting the WPRE region (WPRE_F, CAATCCAGCGGACCTTCCTT; WPRE_rev, AGATCCGACTCGTCTGAGGG) for normal AAVs and the mScarlet region (mScarlet_F, AAGAAGCCCGTGCAGATGCC; mScarlet_R, GCCACGGAGCGTTCGTACTG) for SAGE were performed with 3 μl of the diluted AAV template, 5 μl Power SYBRTM Green PCR Master Mix (Thermo Fisher Scientific, 4368706), 2.5 μM of each primers in a total of 2 μl. qPCR was performed using RioRad CFX 384 system and at conditions as follows: (1) 95 °C for 10 min; (2) 40 cycles of 95 °C for 15 s and 60 °C for 1 min (40 cycles).

Techniques: Immunofluorescence, In Vivo, Transduction, Infection, Gene Knockout, Control, Expressing, Knock-Out

Journal: bioRxiv

Article Title: In vivo interrogation of transcriptional and epigenetic regulators of lung epithelial regeneration

doi: 10.64898/2026.03.13.711474

Figure Lengend Snippet: (A). Two color AAV experiments for quantitative assessment of multi-infection rate for AAV transduction in vivo . Mice were i.t. administered non-engineered eGFP-AAV9: mCherry-AAV9 at 1:1 ratio at indicated total viral loads (4 × 10 9 , 2 × 10 10 , or 1 × 10 11 ) and lungs were harvested five days later. Representative gates were pregated as CD45 - CD31 - Pdgfra - EpCAM + CD104 - MHCII + . (B). Pairwise scatter plots of gRNA abundance in libraries from plasmids, AAVs, and AT2s from biological replicates. (C). Pearson correlation of gRNA abundance in the CM screen derived from plasmids (P), packaged AAV libraries (AAV), and AT2s harvested after injury resolution. Pairwise correlations demonstrate high library representation fidelity across stages. (D). gRNA abundance log 2 fold change (LFC) of control gRNAs and Plk1 gRNAs in the CM and TF screens. Error bars: mean ± SEM. Statistical analysis was using the two-tailed Student’s t -tests. p-values are reported as follows: **p < 0.01.

Article Snippet: In brief, 5 μl of the fraction after ultracentrifugation, isolated AAVs or Addgene AAV standards (Adgene #37825-AAV9) were treated with with DNase I (Merck, 11284932001) at 37 °C for at least 1 hr, followed by Proteinase K digestion at 56 °C for at least 2 hrs before preparing a threefold serial dilutions with ddH2O. qPCR reactions with primers targeting the WPRE region (WPRE_F, CAATCCAGCGGACCTTCCTT; WPRE_rev, AGATCCGACTCGTCTGAGGG) for normal AAVs and the mScarlet region (mScarlet_F, AAGAAGCCCGTGCAGATGCC; mScarlet_R, GCCACGGAGCGTTCGTACTG) for SAGE were performed with 3 μl of the diluted AAV template, 5 μl Power SYBRTM Green PCR Master Mix (Thermo Fisher Scientific, 4368706), 2.5 μM of each primers in a total of 2 μl. qPCR was performed using RioRad CFX 384 system and at conditions as follows: (1) 95 °C for 10 min; (2) 40 cycles of 95 °C for 15 s and 60 °C for 1 min (40 cycles).

Techniques: Infection, Transduction, In Vivo, Derivative Assay, Control, Two Tailed Test

Journal: bioRxiv

Article Title: p75 neurotrophin receptor signaling through the RhoA/ROCK pathway contributes to Alzheimer’s Disease tauopathy

doi: 10.64898/2026.02.22.707328

Figure Lengend Snippet: A) Representative Western blot gels of the WT cerebral cortical neuron infected with either AAV-DJ-GFP or -P301S virus, as indicated. Molecular weights are indicated in kDa. B) Representative Western blot gels of the cerebral cortical neuron from WT and P301S embryos, as indicated. Molecular weights are indicated in kDa.

Article Snippet: AAV-DJ-GFP and -P301S virus were purchased from Vigene Biosciences.

Techniques: Western Blot, Infection, Virus